Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Gene Polymorphism as Risk Factors for Essential Hypertension

Hypertension has relatively large morbidity and mortality rates throughout the world, including in Indonesia. The prevalence of hypertension tends to be greater in patients with a family history of hypertension. This is thought to be influenced by polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene. This study aims to determine the relationship between the polymorphism of C677T and the A1298C MTHFR gene as a risk factor for essential hypertension. An observational study with a case-control design was conducted involving 37 cases and 30 control people. Data obtained by PCR-RFLP. Data analysis was performed using chi-square and odds ratio calculations. The most common genotype for C677T polymorphism is CC (94.6%) followed by CT and TT with 2.7% each (p = 0.001) with OR of 0.099 (CI95% = 0.02-0.49). The most common genotype for the A1298C polymorphism is AC (45.9%), followed by AA (35.1%) and CC (19%) (p = 0.001). The C allele is present in 24 subjects in the case group (64.8%) and in 7 subjects in the control group (23.3%). The OR for the A1298C is 6.06 (CI 95% = 2.1-17.9). The C677T polymorphism showed statistical significance but did not modify the risk factor of essential hypertension. Whereas the A1298C polymorphism is statistically significant and has a 6-fold risk factor for essential hypertension, polymorphism A1298C Methyltetrahydrofolate Reductase (MTHFR) gene is a risk factor of essential hypertension.

A1298C; C677T; Essential hypertension; MTHFR gene; Polymorphism

2.1.  Patient Selection

An analytical study with a case-control design was conducted in the medical faculty of Swadaya Gunung Jati University, Indonesia, to assess the association between Methyltetrahydrofolate Reductase (MTHFR) C677T And A1298C gene polymorphism and essential hypertension. The target population was essential hypertensive patients. We used the purposive sampling method.

The inclusion criteria were all diagnosed with essential hypertensive and ECG normal. Subjects with the following condition were excluded, i.e.: (1) patients with any secondary cause of hypertension; (2) patients with abnormal ECG (4) patients who disagreed with giving blood for the study. Control subjects with the following condition, i.e.: (1) patient with normal blood pressure; (2) patient with normal ECG. (Figure 1) This study was approved by the Ethical Committee of the Faculty of Medicine, Universitas Swadaya Gunung Jati, Cirebon, Indonesia. All patients had signed written informed consent prior to the study. Written informed consent was obtained from all participants prior to enrolment. A written consent was obtained from their parents or guardians for underaged patients. The Institutional Review Board of Faculty of Medicine Universitas Swadaya Gunung Jati, Cirebon, Indonesia, approved the study protocol and followed the ethical principles of the Declaration of Helsinki of 1975 and its revision.

2.2. Blood Collection & DNA Extraction

        Blood samples were collected from the peripheral vein. Then, they were put in EDTA-coated tubes and kept cold. QIAamp kit (Qiagen, Tokyo, Japan) extracted the DNA from leukocytes according to the standard protocol.

2.3. Genetic Analysis

PCR-RFLP for C677T with forward primers 5'TGAAGGAGAAGGTGTCTGCGGGA3' and reverse 5'AGGACGGTGCGGTGAG AGTG3', A1298C with forward primer 5'CAAGGAGGAGCTGCTGAAGA3' and reverse 5'CCACTCCAGCATCACTCACT3'. PCR was conducted using the following settings: C677T initial denaturation at 95 °C for 5 min. Thirty-five cycles of denaturation at 94°C for 30 sec; annealing at 60°C for 30 sec, extension at 2°C for 30 sec, and final extension at 2°C for 5 min. PCR settings for A1298C: initial denaturation at 94°C for 4 min, 30 cycles of denaturation at 94°C for 60 sec, annealing at 60°C for 60 sec, extension at 2°C for 60 sec, and final extension at 2°C for 10 min. The C677T PCR product was then digested using Hinfl and visualized with 1% agarose gel. The Al298C PCR product was subsequently digested using MboII and visualized with 1% agarose gel (Pratamawati et al., 2018).

Figure 1 Work-flow schematics

       This research recruited 34 male patients and 33 female patients, with an average age in the subject's age of 40.30 years old and in the control group of 40.50 years (Table 1). MTHFR C677T genotype distribution in the case group is CC (n=35, 94.6%), CT (n=1, 2.7%), and TT (n=1, 2.7%), and in the control group CC (n=19, 63.4%), CT (n=10, 33.3%), and TT (n=1, 2.7%). The distribution of the C allele is 71 (95.9%) in the case group and 48 in the control group (80%), while the T allele distribution is 3 (4.1%) in the case group and 12 (20%) in the control group (Table 2).

        MTHFR A1298C in the case group is AA (n=13, 35.1%), AC (n=17, 45.9%), and AC (n=7, 19%), and in the control group AA (n=23, 76.7%), AC (n=13.3%), and CC (n=3, 10%). The distribution of the A allele is 43 (58.1%) in the case group and 50 in the control group (83.3%). The distribution of the C allele in the case group is 43 (58.1%) and 50 in the control group (83.3.%).

        Statistical analysis showed significant relations between MTHFR C6777T with essential hypertension but not a risk factor of essential hypertension (p=0.001, OR=0.099), while MTHFR A1298C showed statistical significance with essential hypertension and also a risk factor of essential hypertension (p=0.001, OR=6.06) (Table 3).

Table 1 Demographic data of participants

There is no significant difference in the average age between the case and control groups with similar percentages between male and female subjects in both groups.

Table 2 Allelic and genotype distribution for MTHFR C677T dan A1298C

Table 3 MTHFR C677T dan A1298C polymorphisms and essential hypertension

        In the case group, 64.9% subjects with A1298C MTHFR polymorphism, with only 23.3% in the control group showing a statistically significant relation between A1298C polymorphism and a risk factor for essential hypertension with an odds ratio six times higher than subjects without the polymorphism (p=0.001). In contrast, only two subjects (5.4%) in the case group have the C677T MTHFR polymorphism compared to 11 subjects (36.7%) in the control group with odds ratio <1, meaning that the polymorphism is not statistically significant as a risk factor for essential hypertension.

        This result is different compared to the previous MTHFR C677T research by Candrasarta in 2010 on 213 patients and 202 controls in Indonesia. The research showed a statistical significance p-value of 0.001 and OR of 2.1. The difference in results can probably be attributed to the sample size that made this research statistically significant but not as a risk factor (Candrasatria et al., 2020). The result in this study is similar to previous studies in MTHFR C677T and A1298C in mothers having children with Down syndrome, where the result is not statistically significant for C677T polymorphism but statistically significant for A1298C (Pratamawati et al., 2018). Other research regarding MTHFR A1298C in Indonesian rheumatoid heart disease showed significant results (Nauphar et al., 2019). The results of this study are also in line with the research of Rochmah et al. (2018), there was a significant relationship between MTHFR A1298C and no relationship with C677T in non-syndromic cleft lips/palate cases in the Indonesian Sasak tribe (Rochmah et al., 2018).

Table 4 MTHFR C677T polymorphisms in different populations

                               Abbreviations: SBP: Systolic blood pressure; DBP: Diastolic blood pressure

        We can see the difference between the C667T polymorphisms MTHFR gene in hypertension in different populations, while MTHFR A1298C polymorphism studies are still rarely done in hypertension. 

MTHFR C677T polymorphism is statistically significant with essential hypertension but is not a risk factor in essential hypertension. In contrast, MTHFR A1298C is also statistically significant inessential hypertension and is a risk factor in essential hypertension. Individuals with A1298C polymorphism have a six times increased risk of developing essential hypertension. Findings from this research can be used for further research, such as haplotype analysis or downstream analysis with next-generation sequencing for the MTHFR gene.

We thank Beben Benyamin for his valuable discussions and helpful comments. The Faculty of Medicine Universitas Swadaya Gunung Jati Internal Research Fund 2021 fully funds this research.

Bell, K., Twiggs, J., Olin, B.R., 2015. Hypertension: The Silent Killer: Updated JNC-8 Guideline Recommendations. Alabama Pharmacy Association, Volume 2015, p. 4222

Candrasatria, R.M., Adiarto, S., Sukmawan, R., 2020. Methylenetetrahydrofolate Reductase C677T Gene Polymorphism as a Risk Factor for Hypertension in a Rural Population.  International Journal of Hypertension, Volume 2020, p. 4267246

Carlus SJ, Abdallah AM, Bhaskar LV, Morsy MM, Al-Harbi GS, Al-Mazroea AH, Al-Harbi KM. 2016. The MTHFR C677T polymorphism is associated with mitral valve rheumatic heart disease. Eur Rev Med Pharmacol Sci. Volume 20(1), pp. 109-14.

Choudhury, I., Jothimalar, R., Patra, A.K., 2012. Angiotensin Converting Enzyme Gene Polymorphism and Its Association with Hypertension in South Indian Population.  Indian Journal of Clinical Biochemistry, Volume 27(3), pp. 265–269

Cortese, C., Motti, C., 2001. MTHFR Gene Polymorphism, Homocysteine and Cardiovascular Disease. Public Health Nutrition, Volume 4(2b), pp. 493–497

Deshmukh, A. Rodrigue, K.M., Kennedy, K.M., Land, S., Jacobs, B.S., Raz, N., 2009. Synergistic Effects of The MTHFR C677T Polymorphism and Hypertension on Spatial Navigation. Biological Psychology, Volume 80(2), pp. 240–245

Dhanachandra-Singh, K., Jajodia, A., Kaur, H., Kukreti, R., Karthikeyan, M., 2014. Gender Specific Association of RAS Gene Polymorphism with Essential Hypertension: A Case-Control Study. BioMed Research International, Volume 2014, p. 538053

Evangelou, E., Warren, H.R., Mosen-Ansorena, D., Mifsud, B., Pazoki, R., Gao, H, Ntritsos, G., Dimou, N., Cabrera, C.P., Karaman, I., Ng, F.L., Evangelou, M., Witkowska, K., Tzanis, E., Hellwege, J.N., Giri, A., Edwards, D.R.V.,   Sun, Y.V., Cho, K., Gaziano, J.M., Wilson, P.W.F., Tsao, P.S., Kovesdy, C.P., Esko, T., the Million Veteran Program,  2018. Genetic Analysis of Over 1 million People Identifies 535 New Loci Associated With Blood Pressure Traits’, Nature Genetics, Volume 50(10), pp. 1412–1425

Fridman, O. Porcile, R., Morales, A.V., Gariglio, L.O., Potenzoni, M.A., Turk Noceto, P.C., 2013. Association of Methylenetetrahydrofolate Reductase Gene 677C>T Polymorphism with Hypertension in Older Women in a Population of Buenos Aires City. Clinical and Experimental Hypertension, Volume 35(3), pp. 159–166

Huang, T., Shu, Y., Cai, Y.D., 2015. Genetic Differences Among Ethnic Groups. BMC Genomics, Volume 16(1), pp. 1–10

Kedar, R., Chandel, D., 2019. MTHFR Gene Polymorphism and Associated Nutritional Deficiency in The Etiology and Pathogenesis of Down Syndrome. Egyptian Journal of Medical Human Genetics, Volume 20(1), pp. 1–10

Indonesian Ministry of Health, 2018. Basic Health Research Results, Volume 53(9), pp. 1689-1699.

P2TPM Ministry of Health, 2019.  Hypertension/ high Blood Pressure, P2PTM directorate. Available online at https://p2ptm.kemkes.go.id/infographic/apa-itu-hipertensi-tekanan-darah-tinggi (accessed : 27 November 2022)

Leclerc, D., Sibani, S., Rozen, R., 2013. Molecular Biology of Methylenetetrahydrofolate Reductase (MTHFR) and Overview of Mutations/Polymorphisms. In: Madame Curie Bioscience Database, Landes Bioscience

Nakata, Y., Katsuya, T., Takami, S., Sato, N., Fu, Y., Ishikawa, K., 1998. Methylenetetrahydrofolate Reductase Gene Polymorphism: Relation to Blood Pressure and Cerebrovascular Disease. American Journal of Hypertension, Volume 11 (8), pp. 1019–1023

Nauphar, D., Pratamawati, T.M., Sanif, M.E., 2019. P3132 Methylenetetrahydrofolate Reductase A1298C as a Risk Factor for Rheumatic Heart Disease in Indonesian Population. European Heart Journal, Volume 40, p. ehz745.0207

P2TPM Ministry of Health, 2019. Types of Stroke, P2PTM directorate. Available online at https://p2ptm.kemkes.go.id/infographic-p2ptm/stroke/jenis-jenis-stroke (accessed : 27 November 2022)

Padmanabhan, S., Caulfield, M., Dominiczak, A.F., 2015. Genetic and Molecular Aspects of Hypertension. Circulation Research, Volume 116(6), pp. 937–959

Pratamawati, T.M. Winarni T.I., Hardian, Faradz, S.M.H., 2018. Maternal MTHFR A1298C not C677T Polimorphism as the Risk Factor in Children with Down Syndrome. Research Journal of Medical Sciences, Volume 12(6), pp. 84–89

Rochmah, Y.S., Suwarsi L, Harumsari, S., Sosiawan, A., Fatimah-Muis, S., Faradz, S. M., 2018. Maternal Polymorphism MTHFR A1298C not C677T and MSX1 as the Risk Factors of Non-syndromic Cleft Lips /Palate in Sasak Tribe Indonesia. Journal of Dental and Medical Research, Volume 11(1), pp. 120–123

Shi, J., Liu, S., Guo, Y., Liu, S., Xu, J., Pan, L., Hu, Y., Liu, Y., Cheng, Y., 2021. Association Between eNOS rs1799983 Polymorphism and Hypertension: a Meta-Analysis Involving 14,185 Cases and 13,407 Controls. BMC Cardiovascular Disorders, Volume 21(1), pp. 1–11

Singh, S., Shankar, R., Singh, G.P., 2017. Prevalence and Associated Risk Factors of Hypertension: A Cross-Sectional Study in Urban Varanasi. International Journal of Hypertension, Volume 2017. p. 5491838.

Stover, P.J., MacFarlane, A.J., Field, M.S., 2015. Bringing Clarity to the Role of MTHFR Variants in Neural Tube Defect Prevention. American Journal of Clinical Nutrition, Volume 101(6), pp. 1111–1112

Unger, T., Borghi, C., Charchar, F., Khan, N.A., Poulter, N.R., Prabhakaran, D., Ramirez, A., Schlaich, M., Stergiou, G.S., Tomaszewski, M., Wainford, R.D., Williams, B., Schutte, A. E., 2020. 2020 International Society of Hypertension Global Hypertension Practice Guidelines. Hypertension, Volume 75(6), pp. 1334–1357

Ward, M., Hughes, C.F., Strain, J.J., Reilly, R., Cunningham, C., Molloy, A.M., Horigan, G., Casey, M., McCarroll, K., O’Kane M., Gibney, M.J., Flynn, A., Walton, J., McNulty, B.A., McCann, A., Kirwan, L., Scott, J.M., McNulty, H., 2020. Impact of The Common MTHFR 677C?T Polymorphism on Blood Pressure in Adulthood and Role of Riboflavin in Modifying The Genetic Risk of Hypertension: Evidence From the JINGO Project. BMC Medicine, Volume 18(1), pp. 1–11

Wiemels, J.L., Smith, R.N., Taylor, G.M., Eden, O.B., Alexander, F.E., Greaves, M.F., United Kingdom Childhood Cancer Study investigators, 2001. Methylenetetrahydrofolate Reductase (MTHFR) Polymorphisms and Risk of Molecularly Defined Subtypes of Childhood Acute Leukemia. In: Proceedings of the National Academy of Sciences, Volume 98(7), pp. 4004–4009

Wilson, C.P., McNulty, H., Ward, M., Strain, J.J., Trouton, T.G., Hoeft, B.A., Weber, P., Roos, F.F., Horigan, G., McAnena, L., Scott, J.M., 2013. Blood Pressure in Treated Hypertensive Individuals with the MTHFR 677TT Genotype is Responsive to Intervention with Riboflavin: Findings of z Targeted Randomized Trial. Hypertension, Volume 61(6), pp. 1302–1308

Yin, R.X., Wu, J.Z., Liu, W.Y., Wu, D.F., Cao, X.L., Miao, L., Aung, L.H.H., Zhang, l., Long, X.J., Li, M., Pan, S. L. (2012). Association of Several Lipid-Related Gene Polymorphisms and Blood Pressure Variation in the Bai Ku Yao Population. American Journal of Hypertension, Volume 25(8), pp. 927–936

Zaghloul, A., Iorgoveanu, C., Desai, A., Balakumaran, K., Chen, K., 2019. Methylenetetrahydrofolate Reductase Polymorphism and Premature Coronary Artery Disease. Cureus, Volume 11(6). p. 5014