• International Journal of Technology (IJTech)
  • Vol 13, No 8 (2022)

Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Gene Polymorphism as Risk Factors for Essential Hypertension

Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Gene Polymorphism as Risk Factors for Essential Hypertension

Title: Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Gene Polymorphism as Risk Factors for Essential Hypertension
Tiar Masykuroh Pratamawati, Idrus Alwi, Asmarinah Asmarinah

Corresponding email:


Cite this article as:
Pratamawati, T.M., Alwi, I., Asmarinah, 2022. Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Gene Polymorphism as Risk Factors for Essential Hypertension. International Journal of Technology. Volume 13(8), pp. 1622-1629

1,044
Downloads
Tiar Masykuroh Pratamawati 1. Doctoral Program in Biomedical Sciences, Faculty of Medicine, Universitas Indonesia, Kampus UI Salemba, 10430, Indonesia, 2. Department of Genetics, Faculty of Medicine Universitas Swadaya Gunung
Idrus Alwi Division of Cardiology, Department of Internal Medicine, Faculty of Medicine, Universitas Indonesia/Cipto Mangunkusumo National General Hospital, Kampus UI Salemba, 10430, Indonesia
Asmarinah Asmarinah Department of Medical Biology, Faculty of Medicine, Universitas Indonesia, Kampus UI Salemba, 10430, Indonesia
Email to Corresponding Author

Abstract
Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Gene Polymorphism as Risk Factors for Essential Hypertension

Hypertension has relatively large morbidity and mortality rates throughout the world, including in Indonesia. The prevalence of hypertension tends to be greater in patients with a family history of hypertension. This is thought to be influenced by polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene. This study aims to determine the relationship between the polymorphism of C677T and the A1298C MTHFR gene as a risk factor for essential hypertension. An observational study with a case-control design was conducted involving 37 cases and 30 control people. Data obtained by PCR-RFLP. Data analysis was performed using chi-square and odds ratio calculations. The most common genotype for C677T polymorphism is CC (94.6%) followed by CT and TT with 2.7% each (p = 0.001) with OR of 0.099 (CI95% = 0.02-0.49). The most common genotype for the A1298C polymorphism is AC (45.9%), followed by AA (35.1%) and CC (19%) (p = 0.001). The C allele is present in 24 subjects in the case group (64.8%) and in 7 subjects in the control group (23.3%). The OR for the A1298C is 6.06 (CI 95% = 2.1-17.9). The C677T polymorphism showed statistical significance but did not modify the risk factor of essential hypertension. Whereas the A1298C polymorphism is statistically significant and has a 6-fold risk factor for essential hypertension, polymorphism A1298C Methyltetrahydrofolate Reductase (MTHFR) gene is a risk factor of essential hypertension.

A1298C; C677T; Essential hypertension; MTHFR gene; Polymorphism

Introduction

Essential hypertension is a serious disease that is spread worldwide and can be a severe complication such as stroke, heart attack, retinopathy, and renal failure. Hypertension is a condition when a person's systolic blood pressure (SBP) is ?140 mm Hg and diastolic blood pressure (DBP) is ?90 mm Hg following repeated examination (Unger et al., 2020). According to the Indonesian Ministry of Health, hypertension can be classified into primary hypertension (90% of the case) and secondary hypertension (10% of the case (P2PTM Kementerian Kesehatan, 2019). Hypertension is the leading cause of cardiovascular diseases and the leading cause of death from stroke and ischemic heart disease. Hypertension is dubbed the "silent killer" because 46% of adults do not realize that they have the condition (Bell et al., 2015). West Java is currently the second-highest area with the highest prevalence in the population above 18 years of age at 34.1% (Kemenkes RI, 2018). Several studies have reported a significant correlation between non-communicable diseases, socio-demographic factors, behavior, physical condition, and history of previous sickness (Kemenkes RI, 2018). Singh et al. reported that hypertension is linked to various risk factors such as age, sex, education level, profession, area of domicile, alcohol consumption, and obesity (Singh et al., 2017).

Patients with essential hypertension often present with a wide range of symptoms, including headache, irregular heart rhythm, vision changes, chest pain, nausea, vomiting, and convulsion. Currently, essential hypertension is diagnosed by measuring blood pressure twice using a digital blood pressure monitor with an interval of 5 minutes. If the patient is confirmed for high blood pressure, a follow-up test includes electrocardiography and blood glucose levels to rule out other cardiovascular diseases and diabetes as a cause. Molecular testing for essential hypertension risk is not commonly done in Indonesia, despite the added information it can provide for identifying risk early. Therapy for essential hypertension includes diuretics, angiotensin-converting enzyme inhibitors or angiotensin receptor blockers, beta-blockers, and calcium channel blockers.

Hypertension risk factors that cannot be modified include age, sex, and genetics, while modifiable risk factors include smoking, low-fiber diet, dyslipidemia, salt over-consumption, sedentary lifestyle, stress obesity, and alcohol consumption (Kemenkes RI, 2019).

Several genes have been elucidated as a risk factor for hypertension, but genetic differences between populations greatly affect the outcome (Huang et al., 2015). Genes studied as risk factors for hypertension include the Angiotensin Converting Enzyme (ACE) gene, eNOS gene, Renin-Angiotensin System gene, etc. (Shi et al., 2021; Dhanachandra-Singh et al., 2014; Choudhury et al., 2012). In addition, the MTHFR gene is associated with cardiovascular disorders such as spina bifida, acute leukemia, nutritional deficiency and down syndrome, and premature coronary artery disease. , rheumatoid heart disease and hypertension ( Ward et al., 2020; Zaghloul et al., 2019; Kedar & Chandel, 2019; Carlus et al., 2016;  Wilson et al., 2013; Stover et al., 2015; Cortese & Motti, 2001; Wiemels et al., 2001)

Methylenetetrahydrofolate reductase is an enzyme in the methyl cycle expressed by the MTHFR gene. This gene is located in chromosome 1p36.3 at the base pair of 11.785.730-11.806.103.

       Methylenetetrahydrofolate reductase catalyzes 5,10-methylenetetra hydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocvsteine re-methvlation to methionine. Polymorphism in MTHFR is suspected to be one of the causes of elevated homocysteine, which can lead to increased blood pressure (Leclerc et al., 2013). Genetic research to see the genetic contribution to the phenotype of hypertension cases so that it can have implications for management (Padmanabhan et al., 2015). In addition, it is also known that internal factors such as genetics contribute to the occurrence of primary hypertension. Polymorphisms in hundreds of genes are associated with risk factors for hypertension (Evangelou et al., 2018). This research analyzes the possible involvement of MTHFR C677T and A1298C polymorphisms with essential hypertension. Both polymorphisms have been demonstrated to be involved in developing essential hypertension in various populations but are unknown in the Indonesian population. Genetic markers for essential hypertension can help first-line screening for risk factors in disease development.

Experimental Methods

2.1.  Patient Selection

An analytical study with a case-control design was conducted in the medical faculty of Swadaya Gunung Jati University, Indonesia, to assess the association between Methyltetrahydrofolate Reductase (MTHFR) C677T And A1298C gene polymorphism and essential hypertension. The target population was essential hypertensive patients. We used the purposive sampling method.

The inclusion criteria were all diagnosed with essential hypertensive and ECG normal. Subjects with the following condition were excluded, i.e.: (1) patients with any secondary cause of hypertension; (2) patients with abnormal ECG (4) patients who disagreed with giving blood for the study. Control subjects with the following condition, i.e.: (1) patient with normal blood pressure; (2) patient with normal ECG. (Figure 1) This study was approved by the Ethical Committee of the Faculty of Medicine, Universitas Swadaya Gunung Jati, Cirebon, Indonesia. All patients had signed written informed consent prior to the study. Written informed consent was obtained from all participants prior to enrolment. A written consent was obtained from their parents or guardians for underaged patients. The Institutional Review Board of Faculty of Medicine Universitas Swadaya Gunung Jati, Cirebon, Indonesia, approved the study protocol and followed the ethical principles of the Declaration of Helsinki of 1975 and its revision.

2.2. Blood Collection & DNA Extraction

        Blood samples were collected from the peripheral vein. Then, they were put in EDTA-coated tubes and kept cold. QIAamp kit (Qiagen, Tokyo, Japan) extracted the DNA from leukocytes according to the standard protocol.

2.3. Genetic Analysis

PCR-RFLP for C677T with forward primers 5'TGAAGGAGAAGGTGTCTGCGGGA3' and reverse 5'AGGACGGTGCGGTGAG AGTG3', A1298C with forward primer 5'CAAGGAGGAGCTGCTGAAGA3' and reverse 5'CCACTCCAGCATCACTCACT3'. PCR was conducted using the following settings: C677T initial denaturation at 95 °C for 5 min. Thirty-five cycles of denaturation at 94°C for 30 sec; annealing at 60°C for 30 sec, extension at 2°C for 30 sec, and final extension at 2°C for 5 min. PCR settings for A1298C: initial denaturation at 94°C for 4 min, 30 cycles of denaturation at 94°C for 60 sec, annealing at 60°C for 60 sec, extension at 2°C for 60 sec, and final extension at 2°C for 10 min. The C677T PCR product was then digested using Hinfl and visualized with 1% agarose gel. The Al298C PCR product was subsequently digested using MboII and visualized with 1% agarose gel (Pratamawati et al., 2018).


Figure 1 Work-flow schematics

Results and Discussion

       This research recruited 34 male patients and 33 female patients, with an average age in the subject's age of 40.30 years old and in the control group of 40.50 years (Table 1). MTHFR C677T genotype distribution in the case group is CC (n=35, 94.6%), CT (n=1, 2.7%), and TT (n=1, 2.7%), and in the control group CC (n=19, 63.4%), CT (n=10, 33.3%), and TT (n=1, 2.7%). The distribution of the C allele is 71 (95.9%) in the case group and 48 in the control group (80%), while the T allele distribution is 3 (4.1%) in the case group and 12 (20%) in the control group (Table 2).

        MTHFR A1298C in the case group is AA (n=13, 35.1%), AC (n=17, 45.9%), and AC (n=7, 19%), and in the control group AA (n=23, 76.7%), AC (n=13.3%), and CC (n=3, 10%). The distribution of the A allele is 43 (58.1%) in the case group and 50 in the control group (83.3%). The distribution of the C allele in the case group is 43 (58.1%) and 50 in the control group (83.3.%).

        Statistical analysis showed significant relations between MTHFR C6777T with essential hypertension but not a risk factor of essential hypertension (p=0.001, OR=0.099), while MTHFR A1298C showed statistical significance with essential hypertension and also a risk factor of essential hypertension (p=0.001, OR=6.06) (Table 3).



Figure 2 (Left to Right) Agarose gel of MTHFR C677T polymorphism PCR-RFLP product, digestion result (CC: 198 bp; CT: 198 bp, 175 bp; TT: 175 bp), B: Blank, M: Marker, (b) Al298C RFLP result, M: Mark, B: Blank, digestion result (AA: 72 bp; AC: 100 bp and 72 bp; CC: 100 bp). 

Table 1 Demographic data of participants

Characteristics

Case (n = 37)

Control (n = 30)

p-values

Age

 

 

 

At collection

40.30

40.50

0.070

Sex

 

 

 

Men

22 (59.5%)

18 (60%)

 

Women

15 (40.5%)

12 (40%)

 

There is no significant difference in the average age between the case and control groups with similar percentages between male and female subjects in both groups.

Table 2 Allelic and genotype distribution for MTHFR C677T dan A1298C

Variables

Essential Hypertension (+)

Essential Hypertension (-)

MTHFR C677T

 

 

genotype

 

 

CC

35 (94.6%)

19 (63.4%)

CT

1 (2.7%)

10 (33.3%)

TT

1 (2.7%)

1 (3.3)

Allele

 

 

C

71 (95.9%)

48 (80%)

T

3 (4.1%)

12 (20%)

MTHFR A1298C

 

 

genotype

 

 

AA

13 (35.1%)

23 (76.7%)

AC

17 (45.9%)

4 (13.3%)

CC

7 (19%)

3 (10%)

Allele

 

 

A

43 (58.1%)

50 (83.5%)

C

31 (41.9%)

10 (16.7%)

Table 3 MTHFR C677T dan A1298C polymorphisms and essential hypertension

Variables

Hypertension (+)

Hypertension (-)

OR

p-values

MTHFR C677T

 

 

 

 

Polymorphism

2 (5.4%)

11 (36.7%)

0.099

0.001

Wild Type

35 (94.6%)

19 (63.3%)

1

 

MTHFR A1298C

 

 

 

 

Polymorphism

24 (64.9%)

7 (23.3%)

6.06

0.001

Wild Type

13 (35.1%)

23 (76.7%)

1

 

        In the case group, 64.9% subjects with A1298C MTHFR polymorphism, with only 23.3% in the control group showing a statistically significant relation between A1298C polymorphism and a risk factor for essential hypertension with an odds ratio six times higher than subjects without the polymorphism (p=0.001). In contrast, only two subjects (5.4%) in the case group have the C677T MTHFR polymorphism compared to 11 subjects (36.7%) in the control group with odds ratio <1, meaning that the polymorphism is not statistically significant as a risk factor for essential hypertension.

        This result is different compared to the previous MTHFR C677T research by Candrasarta in 2010 on 213 patients and 202 controls in Indonesia. The research showed a statistical significance p-value of 0.001 and OR of 2.1. The difference in results can probably be attributed to the sample size that made this research statistically significant but not as a risk factor (Candrasatria et al., 2020). The result in this study is similar to previous studies in MTHFR C677T and A1298C in mothers having children with Down syndrome, where the result is not statistically significant for C677T polymorphism but statistically significant for A1298C (Pratamawati et al., 2018). Other research regarding MTHFR A1298C in Indonesian rheumatoid heart disease showed significant results (Nauphar et al., 2019). The results of this study are also in line with the research of Rochmah et al. (2018), there was a significant relationship between MTHFR A1298C and no relationship with C677T in non-syndromic cleft lips/palate cases in the Indonesian Sasak tribe (Rochmah et al., 2018).

Table 4 MTHFR C677T polymorphisms in different populations

First Author

Year

Country

Ethnicity

Diagnostic

genotype

Case

Control

P value

 

Fridman (Fridman et al., 2013)

2013

Argentina

White

SBP >140

DBP > 90

CC: 29

CT: 40

TT: 6

CC: 71

CT: 64

TT: 15

0.917

 

Yin (Yin et al., 2012)

2012

China

Asian

SBP >140

DBP > 90

CC: 244

CT: 358

TT: 68

CC: 322

CT: 309

TT: 51

0.047

 

 

 

 

 

 

 

 

 

 

Nakata (Nakata et al., 1998)

1998

Japan

Asian

SBP >160

DBP > 95

CC: 63

CT: 91

TT: 19

CC: 65

CT: 83

TT: 36

0.309

 

 

 

 

 

 

 

 

 

 

Deshmukh (Deshmukh et al., 2009)

2009

United States

White

SBP >140

DBP > 90

CC: 22

CT: 16

TT: 4

CC: 52

CT: 48

TT: 28

0.221

 

                               Abbreviations: SBP: Systolic blood pressure; DBP: Diastolic blood pressure

        We can see the difference between the C667T polymorphisms MTHFR gene in hypertension in different populations, while MTHFR A1298C polymorphism studies are still rarely done in hypertension. 

Conclusion

MTHFR C677T polymorphism is statistically significant with essential hypertension but is not a risk factor in essential hypertension. In contrast, MTHFR A1298C is also statistically significant inessential hypertension and is a risk factor in essential hypertension. Individuals with A1298C polymorphism have a six times increased risk of developing essential hypertension. Findings from this research can be used for further research, such as haplotype analysis or downstream analysis with next-generation sequencing for the MTHFR gene.

Acknowledgement

We thank Beben Benyamin for his valuable discussions and helpful comments. The Faculty of Medicine Universitas Swadaya Gunung Jati Internal Research Fund 2021 fully funds this research.

References

Bell, K., Twiggs, J., Olin, B.R., 2015. Hypertension: The Silent Killer: Updated JNC-8 Guideline Recommendations. Alabama Pharmacy Association, Volume 2015, p. 4222

Candrasatria, R.M., Adiarto, S., Sukmawan, R., 2020. Methylenetetrahydrofolate Reductase C677T Gene Polymorphism as a Risk Factor for Hypertension in a Rural Population.  International Journal of Hypertension, Volume 2020, p. 4267246

Carlus SJ, Abdallah AM, Bhaskar LV, Morsy MM, Al-Harbi GS, Al-Mazroea AH, Al-Harbi KM. 2016. The MTHFR C677T polymorphism is associated with mitral valve rheumatic heart disease. Eur Rev Med Pharmacol Sci. Volume 20(1), pp. 109-14.

Choudhury, I., Jothimalar, R., Patra, A.K., 2012. Angiotensin Converting Enzyme Gene Polymorphism and Its Association with Hypertension in South Indian Population.  Indian Journal of Clinical Biochemistry, Volume 27(3), pp. 265–269

Cortese, C., Motti, C., 2001. MTHFR Gene Polymorphism, Homocysteine and Cardiovascular Disease. Public Health Nutrition, Volume 4(2b), pp. 493–497

Deshmukh, A. Rodrigue, K.M., Kennedy, K.M., Land, S., Jacobs, B.S., Raz, N., 2009. Synergistic Effects of The MTHFR C677T Polymorphism and Hypertension on Spatial Navigation. Biological Psychology, Volume 80(2), pp. 240–245

Dhanachandra-Singh, K., Jajodia, A., Kaur, H., Kukreti, R., Karthikeyan, M., 2014. Gender Specific Association of RAS Gene Polymorphism with Essential Hypertension: A Case-Control Study. BioMed Research International, Volume 2014, p. 538053

Evangelou, E., Warren, H.R., Mosen-Ansorena, D., Mifsud, B., Pazoki, R., Gao, H, Ntritsos, G., Dimou, N., Cabrera, C.P., Karaman, I., Ng, F.L., Evangelou, M., Witkowska, K., Tzanis, E., Hellwege, J.N., Giri, A., Edwards, D.R.V.,   Sun, Y.V., Cho, K., Gaziano, J.M., Wilson, P.W.F., Tsao, P.S., Kovesdy, C.P., Esko, T., the Million Veteran Program,  2018. Genetic Analysis of Over 1 million People Identifies 535 New Loci Associated With Blood Pressure Traits’, Nature Genetics, Volume 50(10), pp. 1412–1425

Fridman, O. Porcile, R., Morales, A.V., Gariglio, L.O., Potenzoni, M.A., Turk Noceto, P.C., 2013. Association of Methylenetetrahydrofolate Reductase Gene 677C>T Polymorphism with Hypertension in Older Women in a Population of Buenos Aires City. Clinical and Experimental Hypertension, Volume 35(3), pp. 159–166

Huang, T., Shu, Y., Cai, Y.D., 2015. Genetic Differences Among Ethnic Groups. BMC Genomics, Volume 16(1), pp. 1–10

Kedar, R., Chandel, D., 2019. MTHFR Gene Polymorphism and Associated Nutritional Deficiency in The Etiology and Pathogenesis of Down Syndrome. Egyptian Journal of Medical Human Genetics, Volume 20(1), pp. 1–10

Indonesian Ministry of Health, 2018. Basic Health Research Results, Volume 53(9), pp. 1689-1699.

P2TPM Ministry of Health, 2019.  Hypertension/ high Blood Pressure, P2PTM directorate. Available online at https://p2ptm.kemkes.go.id/infographic/apa-itu-hipertensi-tekanan-darah-tinggi (accessed : 27 November 2022)

Leclerc, D., Sibani, S., Rozen, R., 2013. Molecular Biology of Methylenetetrahydrofolate Reductase (MTHFR) and Overview of Mutations/Polymorphisms. In: Madame Curie Bioscience Database, Landes Bioscience

Nakata, Y., Katsuya, T., Takami, S., Sato, N., Fu, Y., Ishikawa, K., 1998. Methylenetetrahydrofolate Reductase Gene Polymorphism: Relation to Blood Pressure and Cerebrovascular Disease. American Journal of Hypertension, Volume 11 (8), pp. 1019–1023

Nauphar, D., Pratamawati, T.M., Sanif, M.E., 2019. P3132 Methylenetetrahydrofolate Reductase A1298C as a Risk Factor for Rheumatic Heart Disease in Indonesian Population. European Heart Journal, Volume 40, p. ehz745.0207

P2TPM Ministry of Health, 2019. Types of Stroke, P2PTM directorate. Available online at https://p2ptm.kemkes.go.id/infographic-p2ptm/stroke/jenis-jenis-stroke (accessed : 27 November 2022)

Padmanabhan, S., Caulfield, M., Dominiczak, A.F., 2015. Genetic and Molecular Aspects of Hypertension. Circulation Research, Volume 116(6), pp. 937–959

Pratamawati, T.M. Winarni T.I., Hardian, Faradz, S.M.H., 2018. Maternal MTHFR A1298C not C677T Polimorphism as the Risk Factor in Children with Down Syndrome. Research Journal of Medical Sciences, Volume 12(6), pp. 84–89

Rochmah, Y.S., Suwarsi L, Harumsari, S., Sosiawan, A., Fatimah-Muis, S., Faradz, S. M., 2018. Maternal Polymorphism MTHFR A1298C not C677T and MSX1 as the Risk Factors of Non-syndromic Cleft Lips /Palate in Sasak Tribe Indonesia. Journal of Dental and Medical Research, Volume 11(1), pp. 120–123

Shi, J., Liu, S., Guo, Y., Liu, S., Xu, J., Pan, L., Hu, Y., Liu, Y., Cheng, Y., 2021. Association Between eNOS rs1799983 Polymorphism and Hypertension: a Meta-Analysis Involving 14,185 Cases and 13,407 Controls. BMC Cardiovascular Disorders, Volume 21(1), pp. 1–11

Singh, S., Shankar, R., Singh, G.P., 2017. Prevalence and Associated Risk Factors of Hypertension: A Cross-Sectional Study in Urban Varanasi. International Journal of Hypertension, Volume 2017. p. 5491838.

Stover, P.J., MacFarlane, A.J., Field, M.S., 2015. Bringing Clarity to the Role of MTHFR Variants in Neural Tube Defect Prevention. American Journal of Clinical Nutrition, Volume 101(6), pp. 1111–1112

Unger, T., Borghi, C., Charchar, F., Khan, N.A., Poulter, N.R., Prabhakaran, D., Ramirez, A., Schlaich, M., Stergiou, G.S., Tomaszewski, M., Wainford, R.D., Williams, B., Schutte, A. E., 2020. 2020 International Society of Hypertension Global Hypertension Practice Guidelines. Hypertension, Volume 75(6), pp. 1334–1357

Ward, M., Hughes, C.F., Strain, J.J., Reilly, R., Cunningham, C., Molloy, A.M., Horigan, G., Casey, M., McCarroll, K., O’Kane M., Gibney, M.J., Flynn, A., Walton, J., McNulty, B.A., McCann, A., Kirwan, L., Scott, J.M., McNulty, H., 2020. Impact of The Common MTHFR 677C?T Polymorphism on Blood Pressure in Adulthood and Role of Riboflavin in Modifying The Genetic Risk of Hypertension: Evidence From the JINGO Project. BMC Medicine, Volume 18(1), pp. 1–11

Wiemels, J.L., Smith, R.N., Taylor, G.M., Eden, O.B., Alexander, F.E., Greaves, M.F., United Kingdom Childhood Cancer Study investigators, 2001. Methylenetetrahydrofolate Reductase (MTHFR) Polymorphisms and Risk of Molecularly Defined Subtypes of Childhood Acute Leukemia. In: Proceedings of the National Academy of Sciences, Volume 98(7), pp. 4004–4009

Wilson, C.P., McNulty, H., Ward, M., Strain, J.J., Trouton, T.G., Hoeft, B.A., Weber, P., Roos, F.F., Horigan, G., McAnena, L., Scott, J.M., 2013. Blood Pressure in Treated Hypertensive Individuals with the MTHFR 677TT Genotype is Responsive to Intervention with Riboflavin: Findings of z Targeted Randomized Trial. Hypertension, Volume 61(6), pp. 1302–1308

Yin, R.X., Wu, J.Z., Liu, W.Y., Wu, D.F., Cao, X.L., Miao, L., Aung, L.H.H., Zhang, l., Long, X.J., Li, M., Pan, S. L. (2012). Association of Several Lipid-Related Gene Polymorphisms and Blood Pressure Variation in the Bai Ku Yao Population. American Journal of Hypertension, Volume 25(8), pp. 927–936

Zaghloul, A., Iorgoveanu, C., Desai, A., Balakumaran, K., Chen, K., 2019. Methylenetetrahydrofolate Reductase Polymorphism and Premature Coronary Artery Disease. Cureus, Volume 11(6). p. 5014